Stem-loop sequence hsa-mir-6848

AccessionMI0022694 (change log)
Symbol HGNC:MIR6848
DescriptionHomo sapiens miR-6848 stem-loop
Stem-loop
   ---  c         ug   ug        u u cuc 
5'    gu ccugggggc  gga  ggccaugg g g   u
      || |||||||||  |||  |||||||| | |    
3'    ca ggacccccg  ucu  cugguguc c c   g
   ccu  a         gu   --        - c cua 
Get sequence
Deep sequencing
66 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 144317246-144317315 [-]
intergenic
Database links

Mature sequence hsa-miR-6848-5p

Accession MIMAT0027596
Sequence

6 - 

ugggggcugggaugggccauggu

 - 28

Get sequence
Deep sequencing40 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6848-3p

Accession MIMAT0027597
Sequence

45 - 

guggucucuuggcccccag

 - 63

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).