Stem-loop sequence hsa-mir-6846

AccessionMI0022692 (change log)
Symbol HGNC:MIR6846
DescriptionHomo sapiens miR-6846 stem-loop
Stem-loop
   cagg      - c    u     ag   a  a 
5'     cugggg g ugga ggggu  agu gg g
       |||||| | |||| |||||  ||| ||  
3'     gauccc c gucu cccca  uca cc a
   ----      u u    u     -g   c  g 
Get sequence
Deep sequencing
29 reads, 20 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 144057321-144057380 [-]
intergenic
Database links

Mature sequence hsa-miR-6846-5p

Accession MIMAT0027592
Sequence

6 - 

ugggggcuggaugggguagagu

 - 27

Get sequence
Deep sequencing20 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6846-3p

Accession MIMAT0027593
Sequence

40 - 

ugaccccuucugucucccuag

 - 60

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).