Stem-loop sequence hsa-mir-6845

AccessionMI0022691 (change log)
Symbol HGNC:MIR6845
DescriptionHomo sapiens miR-6845 stem-loop
Literature search

2 open access papers mention hsa-mir-6845
(2 sentences)

Stem-loop
   aacugc     -   a ca     cccuu  aca 
5'       ggggc cag g  gagag     gc   c
         ||||| ||| |  |||||     ||   c
3'       ccccg guc c  cucuc     cg   a
   ----ga     u   c uc     -----  acc 
Get sequence
Deep sequencing
41 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 143837756-143837816 [-]
intergenic
Database links

Mature sequence hsa-miR-6845-5p

Accession MIMAT0027590
Sequence

6 - 

cggggccagagcagagagc

 - 24

Get sequence
Deep sequencing25 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6845-3p

Accession MIMAT0027591
Sequence

41 - 

ccucuccucccugugccccag

 - 61

Get sequence
Deep sequencing8 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).