Stem-loop sequence hsa-mir-6844

AccessionMI0022690 (change log)
Symbol HGNC:MIR6844
DescriptionHomo sapiens miR-6844 stem-loop
Stem-loop
   ----   c        uuugu    -auca   u 
5'     gaa uuaagaau     agaa     agc a
       ||| ||||||||     ||||     ||| u
3'     cuu aauuuuug     ucuu     ucg u
   gaca   -        ---uu    gaaaa   u 
Get sequence
Deep sequencing
154 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 124508515-124508576 [-]
intergenic
Database links

Mature sequence hsa-miR-6844

Accession MIMAT0027589
Sequence

42 - 

uucuuuguuuuuaauucacag

 - 62

Get sequence
Deep sequencing145 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).