Stem-loop sequence hsa-mir-6843

AccessionMI0022689 (change log)
Symbol HGNC:MIR6843
DescriptionHomo sapiens miR-6843 stem-loop
Stem-loop
   cccccauuuccucaggaauaaaagugcagcagugccugcuguggggaca  u        u      --cug      u   gc       ag  g      
5'                                                  gc gagggcag gaggcc     gggagc gcu  aggcagc  gu ggcgg 
                                                    || |||||||| ||||||     |||||| |||  |||||||  || |||| g
3'                                                  cg cucuuguc cucugg     cccuug cga  ucugucg  cg ccgca 
   -----------------------------------------------ga  u        -      uagua      u   --       ga  a      
Get sequence
Deep sequencing
58 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 27610601-27610751 [-]
sense
OTTHUMT00000376267 ; CCDC25-009; intron 2
OTTHUMT00000376263 ; CCDC25-006; intron 3
OTTHUMT00000376264 ; CCDC25-004; intron 3
OTTHUMT00000255224 ; CCDC25-001; intron 4
OTTHUMT00000376265 ; CCDC25-003; intron 4
OTTHUMT00000376266 ; CCDC25-002; intron 4
OTTHUMT00000376269 ; CCDC25-013; intron 4
OTTHUMT00000376272 ; CCDC25-005; intron 5
ENST00000522915 ; CCDC25-009; intron 2
ENST00000520486 ; CCDC25-006; intron 3
ENST00000520202 ; CCDC25-004; intron 3
ENST00000539095 ; CCDC25-201; intron 3
ENST00000356537 ; CCDC25-001; intron 4
ENST00000523841 ; CCDC25-003; intron 4
ENST00000519509 ; CCDC25-002; intron 4
ENST00000524084 ; CCDC25-013; intron 4
ENST00000517979 ; CCDC25-005; intron 5
antisense
OTTHUMT00000376274 ; RP11-16P20.3-001; intron 2
ENST00000521510 ; RP11-16P20.3-001; intron 2
Database links

Mature sequence hsa-miR-6843-3p

Accession MIMAT0027588
Sequence

131 - 

auggucuccuguucucugcag

 - 151

Get sequence
Deep sequencing31 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).