Stem-loop sequence hsa-mir-6842

AccessionMI0022688 (change log)
Symbol HGNC:MIR6842
DescriptionHomo sapiens miR-6842 stem-loop
Stem-loop
   agcc   -    ug ucu          cuc   g 
5'     cug gggg  g   cuagccaagg   ugg g
       ||| ||||  |   ||||||||||   |||  
3'     gac ccuc  c   ggucgguucc   acu u
   ----   g    gu ucu          --c   c 
Get sequence
Deep sequencing
492 reads, 34.4 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 27433370-27433434 [+]
sense
OTTHUMT00000337557 ; GULOP-001; intron 2
ENST00000454030 ; GULOP-001; intron 2
Database links

Mature sequence hsa-miR-6842-5p

Accession MIMAT0027586
Sequence

6 - 

uggggguggucucuagccaagg

 - 27

Get sequence
Deep sequencing43 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6842-3p

Accession MIMAT0027587
Sequence

44 - 

uuggcuggucucugcuccgcag

 - 65

Get sequence
Deep sequencing438 reads, 44 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).