Stem-loop sequence hsa-mir-6841

AccessionMI0022687 (change log)
Symbol HGNC:MIR6841
DescriptionHomo sapiens miR-6841 stem-loop
Stem-loop
   guguuua   uacu    -     uu    aacaca   guu 
5'        ggg    caga gcaag  guga      ggu   u
          |||    |||| |||||  ||||      |||    
3'        ccc    gucu cguuc  cacu      cca   u
   -----ga   cuac    a     --    ------   auu 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 24953796-24953867 [-]
intergenic
Database links

Mature sequence hsa-miR-6841-5p

Accession MIMAT0027584
Sequence

6 - 

uaggguacucagagcaaguugu

 - 27

Get sequence
Deep sequencing58 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6841-3p

Accession MIMAT0027585
Sequence

52 - 

accuugcaucugcauccccag

 - 72

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).