Stem-loop sequence hsa-mir-6840

AccessionMI0022686 (change log)
Symbol HGNC:MIR6840
DescriptionHomo sapiens miR-6840 stem-loop
Literature search

1 open access papers mention hsa-mir-6840
(1 sentences)

Stem-loop
   u ac      c g      a    cagaucc        
5'  g  cacccc g gcaaag ccug       ccuguua 
    |  |||||| | |||||| ||||       |||||| g
3'  c  gugggg c uguuuc ggac       gggcaga 
   a cc      - g      a    -----cc        
Get sequence
Deep sequencing
141 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 100356651-100356721 [+]
sense
OTTHUMT00000347209 ; ZAN-001; intron 17
OTTHUMT00000347210 ; ZAN-002; intron 17
OTTHUMT00000347211 ; ZAN-003; intron 17
OTTHUMT00000347212 ; ZAN-004; intron 17
OTTHUMT00000347213 ; ZAN-005; intron 17
OTTHUMT00000347214 ; ZAN-006; intron 17
ENST00000546292 ; ZAN-204; intron 16
ENST00000538115 ; ZAN-201; intron 16
ENST00000542585 ; ZAN-202; intron 16
ENST00000546213 ; ZAN-203; intron 16
ENST00000349350 ; ZAN-001; intron 17
ENST00000427578 ; ZAN-002; intron 17
ENST00000443370 ; ZAN-003; intron 17
ENST00000421100 ; ZAN-004; intron 17
ENST00000449052 ; ZAN-005; intron 17
ENST00000348028 ; ZAN-006; intron 17
Database links

Mature sequence hsa-miR-6840-5p

Accession MIMAT0027582
Sequence

6 - 

acccccgggcaaagaccugcagau

 - 29

Get sequence
Deep sequencing80 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6840-3p

Accession MIMAT0027583
Sequence

46 - 

gcccaggacuuugugcggggug

 - 67

Get sequence
Deep sequencing60 reads, 36 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).