Stem-loop sequence hsa-mir-6839

AccessionMI0022685 (change log)
Symbol HGNC:MIR6839
DescriptionHomo sapiens miR-6839 stem-loop
Stem-loop
   uguagu              c                        ---------      gcu 
5'       cuggauugaagaga gacccaagcaggcuuugugugagc         agugag   a
         |||||||||||||| ||||||||||||||||||||||||         ||||||    
3'       gaccuaacuucucu uuggguucguccgaagcacacucg         ucacuu   u
   ------              u                        agcgugggu      auu 
Get sequence
Deep sequencing
277 reads, 0 reads per million, 58 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 64679064-64679176 [+]
sense
OTTHUMT00000460821 ; INTS4L1-002; intron 11
ENST00000587624 ; INTS4L1-002; intron 11
ENST00000297235 ; INTS4L1-201; intron 12
Database links

Mature sequence hsa-miR-6839-5p

Accession MIMAT0027580
Sequence

6 - 

ucuggauugaagagacgaccca

 - 27

Get sequence
Deep sequencing239 reads, 45 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6839-3p

Accession MIMAT0027581
Sequence

92 - 

uuggguuuucucuucaauccag

 - 113

Get sequence
Deep sequencing17 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).