Stem-loop sequence hsa-mir-6837

AccessionMI0022683 (change log)
Symbol HGNC:MIR6837
DescriptionHomo sapiens miR-6837 stem-loop
Stem-loop
   -- ug gac     cca    g   u       c 
5'   g  g   caggg   gcag gaa gucaggg c
     |  |   |||||   |||| ||| |||||||  
3'   c  c   gucuc   uguc cuu caguccc a
   ga gu ---     -ag    a   c       c 
Get sequence
Deep sequencing
225 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 44051766-44051829 [+]
antisense
OTTHUMT00000473061 ; RP5-1022I14.1-001; intron 3
OTTHUMT00000473170 ; RP5-1165K10.2-001; intron 3
OTTHUMT00000473169 ; RP5-1022I14.1-002; intron 4
ENST00000422304 ; POLR2J4-001; intron 3
ENST00000454572 ; RP5-1165K10.2-001; intron 3
ENST00000427076 ; POLR2J4-002; intron 4
Database links

Mature sequence hsa-miR-6837-5p

Accession MIMAT0027576
Sequence

6 - 

accagggccagcagggaaugu

 - 26

Get sequence
Deep sequencing190 reads, 31 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6837-3p

Accession MIMAT0027577
Sequence

42 - 

ccuucacugugacucugcugcag

 - 64

Get sequence
Deep sequencing34 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).