Stem-loop sequence hsa-mir-6835

AccessionMI0022680 (change log)
Symbol HGNC:MIR6835
DescriptionHomo sapiens miR-6835 stem-loop
Stem-loop
   ugauga     -       ug   gaagcg    g 
5'       ggggg uagaaag  gcu      agau u
         ||||| |||||||  |||      ||||  
3'       cccuc gucuuuu  cga      ucug u
   ----ga     u       ca   ---aaa    u 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 34240673-34240736 [+]
intergenic
Database links

Mature sequence hsa-miR-6835-5p

Accession MIMAT0027570
Sequence

6 - 

aggggguagaaaguggcugaag

 - 27

Get sequence
Deep sequencing37 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6835-3p

Accession MIMAT0027571
Sequence

42 - 

aaaagcacuuuucugucucccag

 - 64

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).