Stem-loop sequence hsa-mir-6834

AccessionMI0022679 (change log)
Symbol HGNC:MIR6834
DescriptionHomo sapiens miR-6834 stem-loop
Stem-loop
   ----- u      c      u    gggc  gga      -  ua 
5'      g gaggga ugggau ugug    ga   gggacc ug  c
        | |||||| |||||| ||||    ||   |||||| ||  u
3'      c cucccu acccug auac    cu   ucuugg ac  a
   gacua -      -      u    ---a  -ag      u  cg 
Get sequence
Deep sequencing
57 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 33290245-33290325 [+]
antisense
OTTHUMT00000076404 ; DAXX-002; intron 1
OTTHUMT00000076403 ; DAXX-001; intron 1
OTTHUMT00000076407 ; DAXX-009; intron 1
OTTHUMT00000139537 ; DAXX-004; intron 1
OTTHUMT00000139538 ; DAXX-007; intron 1
OTTHUMT00000076405 ; DAXX-003; intron 1
OTTHUMT00000276430 ; DAXX-011; intron 1
OTTHUMT00000076409 ; DAXX-005; intron 2
ENST00000266000 ; DAXX-002; intron 1
ENST00000374542 ; DAXX-001; intron 1
ENST00000468536 ; DAXX-009; intron 1
ENST00000477370 ; DAXX-004; intron 1
ENST00000446403 ; DAXX-007; intron 1
ENST00000498030 ; DAXX-003; intron 1
ENST00000446511 ; DAXX-011; intron 1
ENST00000414083 ; DAXX-201; intron 1
ENST00000453407 ; DAXX-005; intron 2
Clustered miRNAs
< 10kb from hsa-mir-6834
hsa-mir-6873chr6: 33287227-33287289 [-]
hsa-mir-6834chr6: 33290245-33290325 [+]
Database links

Mature sequence hsa-miR-6834-5p

Accession MIMAT0027568
Sequence

1 - 

gugagggacugggauuugugg

 - 21

Get sequence
Deep sequencing25 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6834-3p

Accession MIMAT0027569
Sequence

61 - 

uaugucccaucccuccauca

 - 80

Get sequence
Deep sequencing28 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).