Stem-loop sequence hsa-mir-6833

AccessionMI0022678 (change log)
Symbol HGNC:MIR6833
DescriptionHomo sapiens miR-6833 stem-loop
Literature search

1 open access papers mention hsa-mir-6833
(1 sentences)

Stem-loop
   aaacgg  u     a   ga       aaucc 
5'       ug ggaag ugg  ggagaaa     c
         || ||||| |||  |||||||     u
3'       ac ccuuc acc  ucucuuu     g
   -----g  u     -   uc       caauu 
Get sequence
Deep sequencing
196 reads, 1.28 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 32179816-32179876 [+]
antisense
OTTHUMT00000269000 ; NOTCH4-004; intron 4
OTTHUMT00000076045 ; NOTCH4-001; intron 17
ENST00000465528 ; NOTCH4-004; intron 4
ENST00000375023 ; NOTCH4-001; intron 17
Clustered miRNAs
< 10kb from hsa-mir-6833
hsa-mir-6721chr6: 32170030-32170116 [-]
hsa-mir-6833chr6: 32179816-32179876 [+]
Database links

Mature sequence hsa-miR-6833-5p

Accession MIMAT0027566
Sequence

6 - 

guguggaagaugggaggagaaa

 - 27

Get sequence
Deep sequencing58 reads, 35 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6833-3p

Accession MIMAT0027567
Sequence

41 - 

uuucucucuccacuuccucag

 - 61

Get sequence
Deep sequencing74 reads, 35 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).