Stem-loop sequence hsa-mir-6832

AccessionMI0022677 (change log)
Symbol HGNC:MIR6832
DescriptionHomo sapiens miR-6832 stem-loop
Stem-loop
   gg   a u          aguu         ---g  aga 
5'   ugg g agagaggaaa    agggucagu    gc   g
     ||| | ||||||||||    |||||||||    ||    
3'   acc c uuucucuuuu    ucccagucg    cg   c
   -g   - -          ----         uaga  gac 
Get sequence
Deep sequencing
219 reads, 12.1 reads per million, 58 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 31633787-31633858 [+]
sense
OTTHUMT00000076068 ; CSNK2B-004; intron 1
OTTHUMT00000076063 ; CSNK2B-001; 3'UTR (exon 1)
ENST00000375885 ; CSNK2B-004; intron 1
ENST00000375882 ; CSNK2B-001; 3'UTR (exon 1)
antisense
OTTHUMT00000144445 ; GPANK1-003; 5'UTR (exon 1)
ENST00000375906 ; GPANK1-003; 5'UTR (exon 1)
Database links

Mature sequence hsa-miR-6832-5p

Accession MIMAT0027564
Sequence

6 - 

aguagagaggaaaaguuaggguc

 - 28

Get sequence
Deep sequencing159 reads, 33 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6832-3p

Accession MIMAT0027565
Sequence

53 - 

acccuuuuucucuuucccag

 - 72

Get sequence
Deep sequencing44 reads, 26 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).