Stem-loop sequence hsa-mir-6831

AccessionMI0022676 (change log)
Symbol HGNC:MIR6831
DescriptionHomo sapiens miR-6831 stem-loop
Stem-loop
   guag        uga    ga    ugagcccaugu ug   c 
5'     guagagug   ggag  gguc           g  gac u
       ||||||||   ||||  ||||           |  |||  
3'     caucucac   ccuc  ucag           c  cug a
   --ga        ---    aa    --ucaaauugu gu   g 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 140563671-140563751 [-]
antisense
OTTHUMT00000251800 ; PCDHB16-001; 3'UTR (exon 1)
ENST00000361016 ; PCDHB16-001; 3'UTR (exon 1)
Database links

Mature sequence hsa-miR-6831-5p

Accession MIMAT0027562
Sequence

2 - 

uagguagagugugaggaggagguc

 - 25

Get sequence
Deep sequencing27 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6831-3p

Accession MIMAT0027563
Sequence

61 - 

ugacuaacucccacucuacag

 - 81

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).