Stem-loop sequence hsa-mir-6830

AccessionMI0022675 (change log)
Symbol HGNC:MIR6830
DescriptionHomo sapiens miR-6830 stem-loop
Stem-loop
   gugccc     a  -    cu       ccucaucu 
5'       caagg ag gagg  ggacauc        g
         ||||| || ||||  |||||||         
3'       guucc uc cuuc  ucugugg        u
   ---gac     c  u    uu       ucacucuu 
Get sequence
Deep sequencing
55 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 132217849-132217918 [-]
sense
OTTHUMT00000133049 ; AFF4-001; intron 20
ENST00000265343 ; AFF4-001; intron 20
Database links

Mature sequence hsa-miR-6830-5p

Accession MIMAT0027560
Sequence

6 - 

ccaaggaaggaggcuggacauc

 - 27

Get sequence
Deep sequencing20 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6830-3p

Accession MIMAT0027561
Sequence

48 - 

ugucuuucuucucucccuugcag

 - 70

Get sequence
Deep sequencing24 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).