Stem-loop sequence hsa-mir-6829

AccessionMI0022674 (change log)
Symbol HGNC:MIR6829
DescriptionHomo sapiens miR-6829 stem-loop
Stem-loop
   cagcg  -   ug u   aa         uccucca 
5'      ug ggc  c gag  ggggcaggg       g
        || |||  | |||  |||||||||        
3'      ac ccg  g cuc  cuccguccu       c
   ----g  u   gu c   --         ccuuacu 
Get sequence
Deep sequencing
113 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 195882329-195882395 [-]
antisense
OTTHUMT00000341345 ; AC139666.1-001; intron 2
ENST00000457079 ; LINC00885-001; intron 2
Database links

Mature sequence hsa-miR-6829-5p

Accession MIMAT0027558
Sequence

6 - 

ugggcugcugagaaggggca

 - 25

Get sequence
Deep sequencing92 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6829-3p

Accession MIMAT0027559
Sequence

48 - 

ugccuccuccguggccucag

 - 67

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).