Stem-loop sequence hsa-mir-6828

AccessionMI0022673 (change log)
Symbol HGNC:MIR6828
DescriptionHomo sapiens miR-6828 stem-loop
Stem-loop
   ggcuca  a         a ccu    ucua 
5'       gg agcaagaga c   gugg    a
         || ||||||||| |   ||||    c
3'       cc uuguucucu g   uacc    c
   ----ga  c         c -uc    cuuu 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 170423103-170423162 [+]
sense
OTTHUMT00000352414 ; CLDN11-002; intron 2
OTTHUMT00000352442 ; CLDN11-010; intron 2
ENST00000486975 ; CLDN11-002; intron 2
ENST00000480067 ; CLDN11-010; intron 2
ENST00000451576 ; CLDN11-201; intron 2
Database links

Mature sequence hsa-miR-6828-5p

Accession MIMAT0027556
Sequence

6 - 

aggaagcaagagaacccugugg

 - 27

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6828-3p

Accession MIMAT0027557
Sequence

41 - 

aucugcucucuuguucccag

 - 60

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).