Stem-loop sequence hsa-mir-6827

AccessionMI0022672 (change log)
Symbol HGNC:MIR6827
DescriptionHomo sapiens miR-6827 stem-loop
Gene family MIPF0001747; mir-6827
Stem-loop
   u    ug     cau     u u     gu 
5'  cugg  ggagc   gaggg c gugcu  c
    ||||  |||||   ||||| | |||||  u
3'  gacc  ccuug   uucuc g cacga  c
   -    --     -uc     u c     gu 
Get sequence
Deep sequencing
105 reads, 0 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 134367804-134367862 [-]
sense
OTTHUMT00000357324 ; KY-005; intron 1
OTTHUMT00000357320 ; KY-001; intron 1
OTTHUMT00000357323 ; KY-004; intron 1
OTTHUMT00000357321 ; KY-002; intron 1
ENST00000508956 ; KY-005; intron 1
ENST00000423778 ; KY-001; intron 1
ENST00000503669 ; KY-004; intron 1
ENST00000506319 ; KY-002; intron 1
antisense
OTTHUMT00000357425 ; EPHB1-004; intron 1
OTTHUMT00000357424 ; EPHB1-003; intron 2
ENST00000460895 ; EPHB1-004; intron 1
ENST00000467708 ; EPHB1-003; intron 2
Database links

Mature sequence hsa-miR-6827-5p

Accession MIMAT0027554
Sequence

6 - 

ugggagccaugagggucugugc

 - 27

Get sequence
Deep sequencing68 reads, 44 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6827-3p

Accession MIMAT0027555
Sequence

39 - 

accgucucuucuguuccccag

 - 59

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).