Stem-loop sequence hsa-mir-6826

AccessionMI0022671 (change log)
Symbol HGNC:MIR6826
DescriptionHomo sapiens miR-6826 stem-loop
Stem-loop
   cuugguc             u    ccuccug    uuc uc    gcau  cu 
5'        aauaggaaagagg ggga       gcuu   c  ugca    gg  c
          ||||||||||||| ||||       ||||   |  ||||    ||   
3'        uuguccuuucucu cccu       cgaa   g  acgu    cc  g
   ----gac             c    -------    uuu ua    -gau  ag 
Get sequence
Deep sequencing
283 reads, 3.64 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 129272146-129272243 [+]
intergenic
Database links

Mature sequence hsa-miR-6826-5p

Accession MIMAT0027552
Sequence

6 - 

ucaauaggaaagaggugggaccu

 - 28

Get sequence
Deep sequencing244 reads, 38 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6826-3p

Accession MIMAT0027553
Sequence

77 - 

cuccccucucuuuccuguucag

 - 98

Get sequence
Deep sequencing21 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).