Stem-loop sequence hsa-mir-6825

AccessionMI0022670 (change log)
Symbol HGNC:MIR6825
DescriptionHomo sapiens miR-6825 stem-loop
Literature search

3 open access papers mention hsa-mir-6825
(4 sentences)

Stem-loop
   gg  au       u    a      a       a 
5'   gc  ggggagg gugg gucagc uggggcu g
     ||  ||||||| |||| |||||| |||||||  
3'   cg  ccucuuc cgcc cagucg gccccgg g
   ga  --       -    -      c       a 
Get sequence
Deep sequencing
228 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 127575266-127575331 [-]
intergenic
Database links

Mature sequence hsa-miR-6825-5p

Accession MIMAT0027550
Sequence

6 - 

uggggagguguggagucagcau

 - 27

Get sequence
Deep sequencing220 reads, 39 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6825-3p

Accession MIMAT0027551
Sequence

44 - 

gcgcugacccgccuucuccgca

 - 65

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).