Stem-loop sequence hsa-mir-6824

AccessionMI0022669 (change log)
Symbol HGNC:MIR6824
DescriptionHomo sapiens miR-6824 stem-loop
Literature search

1 open access papers mention hsa-mir-6824
(1 sentences)

Stem-loop
   gaggugua    a   u          u  - uu 
5'         gggg ggu gggccaggga gc c  c
           |||| ||| |||||||||| || |   
3'         cccc ccg ucuggucucu ug g  a
   ------ga    a   u          c  u uc 
Get sequence
Deep sequencing
71 reads, 0 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 48633636-48633698 [-]
intergenic
Database links

Mature sequence hsa-miR-6824-5p

Accession MIMAT0027548
Sequence

6 - 

guaggggagguugggccaggga

 - 27

Get sequence
Deep sequencing17 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6824-3p

Accession MIMAT0027549
Sequence

43 - 

ucucuggucuugccaccccag

 - 63

Get sequence
Deep sequencing22 reads, 16 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).