Stem-loop sequence hsa-mir-6823

AccessionMI0022668 (change log)
Symbol HGNC:MIR6823
DescriptionHomo sapiens miR-6823 stem-loop
Literature search

1 open access papers mention hsa-mir-6823
(1 sentences)

Stem-loop
   caa  uc    uu  u       g uguu   g 
5'    gg  aggg  gg agggguu c    gcu u
      ||  ||||  || ||||||| |    ||| g
3'    cc  uccc  cc ucuccga g    cga a
   -ga  --    uu  -       - ---u   a 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 48549961-48550021 [-]
intergenic
Database links

Mature sequence hsa-miR-6823-5p

Accession MIMAT0027546
Sequence

6 - 

ucaggguugguagggguugcu

 - 26

Get sequence
Deep sequencing43 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6823-3p

Accession MIMAT0027547
Sequence

41 - 

ugagccucuccuucccuccag

 - 61

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).