Stem-loop sequence hsa-mir-6821

AccessionMI0022666 (change log)
Symbol HGNC:MIR6821
DescriptionHomo sapiens miR-6821 stem-loop
Literature search

1 open access papers mention hsa-mir-6821
(3 sentences)

Stem-loop
   --     ug    cuc    -     gug       -c    
5'   gugcg  gugg   gagg cgggg   ggggccu  gcc 
     |||||  ||||   |||| |||||   |||||||  || c
3'   cacgc  cgcc   cucc guccc   ucccggg  cgu 
   ga     cu    --u    a     ---       uu    
Get sequence
Deep sequencing
60 reads, 5.41 reads per million, 37 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 49962866-49962939 [+]
antisense
OTTHUMT00000317433 ; C22orf34-004; intron 1
OTTHUMT00000317434 ; C22orf34-005; intron 1
ENST00000414287 ; C22orf34-004; intron 1
ENST00000416411 ; C22orf34-005; intron 1
Database links

Mature sequence hsa-miR-6821-5p

Accession MIMAT0027542
Sequence

1 - 

gugcgugguggcucgaggcgggg

 - 23

Get sequence
Deep sequencing28 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6821-3p

Accession MIMAT0027543
Sequence

54 - 

ugaccucuccgcuccgcacag

 - 74

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).