Stem-loop sequence hsa-mir-6820

AccessionMI0022665 (change log)
Symbol HGNC:MIR6820
DescriptionHomo sapiens miR-6820 stem-loop
Stem-loop
   ccuu   c     a cu        c  cc u 
5'     cug ggcag g  ggggucac ag  c c
       ||| ||||| |  |||||||| ||  |  
3'     gac ccguc c  cuucagug uc  g a
   ----   a     c cu        u  au u 
Get sequence
Deep sequencing
325 reads, 0 reads per million, 82 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 37967563-37967624 [+]
antisense
OTTHUMT00000318991 ; LGALS2-001; intron 2
ENST00000215886 ; LGALS2-001; intron 2
Database links

Mature sequence hsa-miR-6820-5p

Accession MIMAT0027540
Sequence

6 - 

ugcggcagagcugggguca

 - 24

Get sequence
Deep sequencing198 reads, 61 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6820-3p

Accession MIMAT0027541
Sequence

41 - 

ugugacuucuccccugccacag

 - 62

Get sequence
Deep sequencing121 reads, 35 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).