Stem-loop sequence hsa-mir-6819

AccessionMI0022664 (change log)
Symbol HGNC:MIR6819
DescriptionHomo sapiens miR-6819 stem-loop
Literature search

1 open access papers mention hsa-mir-6819
(1 sentences)

Stem-loop
   gagggu        a    ca  ga   g   g 
5'       uggggugg gggc  ag  gcu ggu g
         |||||||| ||||  ||  ||| ||| g
3'       accccacc ccug  uc  cga ccg g
   -----g        -    --  uc   a   u 
Get sequence
Deep sequencing
61 reads, 0 reads per million, 27 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 36286847-36286907 [-]
sense
OTTHUMT00000319333 ; RBFOX2-006; intron 1
OTTHUMT00000319299 ; RBFOX2-005; intron 2
OTTHUMT00000319339 ; RBFOX2-012; intron 2
ENST00000359369 ; RBFOX2-006; intron 1
ENST00000438146 ; RBFOX2-005; intron 2
ENST00000408983 ; RBFOX2-012; intron 2
Database links

Mature sequence hsa-miR-6819-5p

Accession MIMAT0027538
Sequence

6 - 

uugggguggagggccaaggagc

 - 27

Get sequence
Deep sequencing31 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6819-3p

Accession MIMAT0027539
Sequence

41 - 

aagccucuguccccaccccag

 - 61

Get sequence
Deep sequencing26 reads, 10 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).