Stem-loop sequence hsa-mir-6818

AccessionMI0022663 (change log)
Symbol HGNC:MIR6818
DescriptionHomo sapiens miR-6818 stem-loop
Stem-loop
   cuauuu        -u   -    --   u   aau 
5'       ugugugag  aca gaga  gca cug   g
         ||||||||  ||| ||||  ||| |||    
3'       acacacuc  ugu cucu  ugu gac   g
   -----g        cu   u    gu   u   aug 
Get sequence
Deep sequencing
261 reads, 5.41 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 30007049-30007113 [+]
sense
OTTHUMT00000075615 ; NF2-001; intron 1
OTTHUMT00000322027 ; NF2-004; intron 1
OTTHUMT00000322036 ; NF2-010; intron 1
OTTHUMT00000322026 ; NF2-003; intron 1
OTTHUMT00000322031 ; NF2-008; intron 1
OTTHUMT00000322028 ; NF2-005; intron 1
OTTHUMT00000277090 ; NF2-002; intron 1
OTTHUMT00000322030 ; NF2-007; intron 1
OTTHUMT00000322029 ; NF2-006; intron 1
OTTHUMT00000322035 ; NF2-009; intron 1
ENST00000338641 ; NF2-001; intron 1
ENST00000403435 ; NF2-004; intron 1
ENST00000361452 ; NF2-010; intron 1
ENST00000403999 ; NF2-003; intron 1
ENST00000334961 ; NF2-008; intron 1
ENST00000353887 ; NF2-005; intron 1
ENST00000432151 ; NF2-002; intron 1
ENST00000361166 ; NF2-007; intron 1
ENST00000361676 ; NF2-006; intron 1
ENST00000397789 ; NF2-009; intron 1
ENST00000413209 ; NF2-202; intron 1
ENST00000347330 ; NF2-201; intron 1
Database links

Mature sequence hsa-miR-6818-5p

Accession MIMAT0027536
Sequence

6 - 

uugugugaguacagagagcauc

 - 27

Get sequence
Deep sequencing186 reads, 66 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6818-3p

Accession MIMAT0027537
Sequence

44 - 

uugucucuuguuccucacacag

 - 65

Get sequence
Deep sequencing74 reads, 28 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).