Stem-loop sequence hsa-mir-6816

AccessionMI0022661 (change log)
Symbol HGNC:MIR6816
DescriptionHomo sapiens miR-6816 stem-loop
Literature search

1 open access papers mention hsa-mir-6816
(1 sentences)

Stem-loop
   ccga     - c   -        cug   - gac 
5'     guggg g ggg gcaggucc   cag g   u
       ||||| | ||| ||||||||   ||| |    
3'     caccc c ucc cguccagg   guc c   g
   --ga     g u   a        -aa   a agu 
Get sequence
Deep sequencing
144 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 20114686-20114751 [-]
antisense
OTTHUMT00000318409 ; RANBP1-003; exon 2
OTTHUMT00000319851 ; RANBP1-011; exon 4
OTTHUMT00000318408 ; RANBP1-002; exon 6
OTTHUMT00000318392 ; RANBP1-001; exon 6
OTTHUMT00000343733 ; RANBP1-015; exon 6
ENST00000486575 ; RANBP1-003; exon 2
ENST00000448394 ; RANBP1-011; exon 4
ENST00000435265 ; RANBP1-002; exon 6
ENST00000402752 ; RANBP1-001; exon 6
ENST00000331821 ; RANBP1-015; exon 6
ENST00000430524 ; RANBP1-201; exon 6
Database links

Mature sequence hsa-miR-6816-5p

Accession MIMAT0027532
Sequence

6 - 

uggggcggggcaggucccugc

 - 26

Get sequence
Deep sequencing22 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6816-3p

Accession MIMAT0027533
Sequence

42 - 

gaaggaccugcaccuucg

 - 59

Get sequence
Deep sequencing117 reads, 36 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).