Stem-loop sequence hsa-mir-6815

AccessionMI0022660 (change log)
Symbol HGNC:MIR6815
DescriptionHomo sapiens miR-6815 stem-loop
Stem-loop
   ca   ua    gc  c            uccc 
5'   cug  ggug  gc ggaggagucauu    a
     |||  ||||  || ||||||||||||     
3'   gac  ccac  cg ucucuucgguaa    u
   --   --    -a  u            ucac 
Get sequence
Deep sequencing
136 reads, 0 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 45478266-45478326 [+]
sense
OTTHUMT00000195739 ; TRAPPC10-003; intron 5
OTTHUMT00000195737 ; TRAPPC10-001; intron 5
OTTHUMT00000195738 ; TRAPPC10-002; intron 5
ENST00000380221 ; TRAPPC10-003; intron 5
ENST00000291574 ; TRAPPC10-001; intron 5
ENST00000422875 ; TRAPPC10-002; intron 5
Database links

Mature sequence hsa-miR-6815-5p

Accession MIMAT0027530
Sequence

6 - 

uagguggcgccggaggagucauu

 - 28

Get sequence
Deep sequencing124 reads, 68 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6815-3p

Accession MIMAT0027531
Sequence

41 - 

uggcuucucuugcacacccag

 - 61

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).