Stem-loop sequence hsa-mir-6814

AccessionMI0022659 (change log)
Symbol HGNC:MIR6814
DescriptionHomo sapiens miR-6814 stem-loop
Stem-loop
   uuuc  c       uga     ugccacccagcccu 
5'     cu ccaaggg   gaugc              g
       || |||||||   |||||               
3'     ga gguuccc   cuacg              c
   ----  c       uuc     cucaguccccgaga 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 41746772-41746841 [-]
sense
OTTHUMT00000195029 ; DSCAM-001; intron 3
ENST00000400454 ; DSCAM-001; intron 3
Database links

Mature sequence hsa-miR-6814-5p

Accession MIMAT0027528
Sequence

6 - 

ucccaagggugagaugcugcca

 - 27

Get sequence
Deep sequencing17 reads, 13 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6814-3p

Accession MIMAT0027529
Sequence

49 - 

acucgcauccuucccuuggcag

 - 70

Get sequence
Deep sequencing21 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).