Stem-loop sequence hsa-mir-6813

AccessionMI0022658 (change log)
Symbol HGNC:MIR6813
DescriptionHomo sapiens miR-6813 stem-loop
Literature search

1 open access papers mention hsa-mir-6813
(1 sentences)

Stem-loop
   guaggca    -cu      uc       c 
5'        gggg   gggguu  agguucu a
          ||||   ||||||  ||||||| g
3'        cccc   ccccgg  uccaaga u
   -----ga    ucu      -u       c 
Get sequence
Deep sequencing
119 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 64076955-64077010 [-]
intergenic
Database links

Mature sequence hsa-miR-6813-5p

Accession MIMAT0027526
Sequence

6 - 

caggggcugggguuucagguucu

 - 28

Get sequence
Deep sequencing107 reads, 31 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6813-3p

Accession MIMAT0027527
Sequence

36 - 

aaccuuggccccucuccccag

 - 56

Get sequence
Deep sequencing12 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).