Stem-loop sequence hsa-mir-6812

AccessionMI0022657 (change log)
Symbol HGNC:MIR6812
DescriptionHomo sapiens miR-6812 stem-loop
Stem-loop
   ugagga      g gau          a cc  uc 
5'       uggggu a   ggggaggagc g  ag  c
         |||||| |   |||||||||| |  ||   
3'       acccca u   ccccuucucg c  uc  u
   -----g      g ---          c ac  ug 
Get sequence
Deep sequencing
1364 reads, 90.4 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 45425510-45425573 [+]
intergenic
Database links

Mature sequence hsa-miR-6812-5p

Accession MIMAT0027524
Sequence

6 - 

auggggugagauggggaggagcagc

 - 30

Get sequence
Deep sequencing1333 reads, 37 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6812-3p

Accession MIMAT0027525
Sequence

44 - 

ccgcucuuccccugaccccag

 - 64

Get sequence
Deep sequencing21 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).