Stem-loop sequence hsa-mir-6810

AccessionMI0022655 (change log)
Symbol HGNC:MIR6810
DescriptionHomo sapiens miR-6810 stem-loop
Stem-loop
   cuggga      -     auc    u  c     ucca 
5'       ugggga caggg   agca gg acaga    a
         |||||| |||||   |||| || |||||     
3'       accccu guucc   ucgu cc ugucu    u
   -----g      u     --c    c  c     ucca 
Get sequence
Deep sequencing
176 reads, 0 reads per million, 59 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 218341911-218341980 [+]
antisense
OTTHUMT00000339331 ; DIRC3-003; intron 2
OTTHUMT00000339330 ; DIRC3-002; intron 3
ENST00000474063 ; DIRC3-003; intron 2
ENST00000486365 ; DIRC3-002; intron 3
Database links

Mature sequence hsa-miR-6810-5p

Accession MIMAT0027520
Sequence

6 - 

auggggacagggaucagcauggc

 - 28

Get sequence
Deep sequencing120 reads, 43 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6810-3p

Accession MIMAT0027521
Sequence

48 - 

uccccugcucccuuguuccccag

 - 70

Get sequence
Deep sequencing45 reads, 34 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).