Stem-loop sequence hsa-mir-6808

AccessionMI0022653 (change log)
Symbol HGNC:MIR6808
DescriptionHomo sapiens miR-6808 stem-loop
Stem-loop
   ggggccag       -     gac     ggg 
5'         gcaggga ggugg   caugg   c
           ||||||| |||||   |||||    
3'         cguccuu ccacc   guguc   c
   ------ga       g     agu     guu 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 1339650-1339708 [-]
sense
OTTHUMT00000008144 ; MRPL20-006; intron 2
OTTHUMT00000008140 ; MRPL20-002; intron 2
OTTHUMT00000008145 ; MRPL20-004; intron 2
OTTHUMT00000008139 ; MRPL20-001; intron 3
ENST00000493287 ; MRPL20-006; intron 2
ENST00000487659 ; MRPL20-002; intron 2
ENST00000492508 ; MRPL20-004; intron 2
ENST00000344843 ; MRPL20-001; intron 3
Database links

Mature sequence hsa-miR-6808-5p

Accession MIMAT0027516
Sequence

6 - 

caggcagggaggugggaccaug

 - 27

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6808-3p

Accession MIMAT0027517
Sequence

39 - 

gugugaccaccguuccugcag

 - 59

Get sequence
Deep sequencing36 reads, 18 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).