Stem-loop sequence hsa-mir-6807

AccessionMI0022652 (change log)
Symbol HGNC:MIR6807
DescriptionHomo sapiens miR-6807 stem-loop
Literature search

1 open access papers mention hsa-mir-6807
(1 sentences)

Stem-loop
   g  a    -  -      g  a  --cu     - ag  ggagaugu 
5'  ug gcca gu ggaaug ag gg    guggg c  gg        g
    || |||| || |||||| || ||    ||||| |  ||        a
3'  ac cggu cg ccuuac uc cc    uaccc g  uc        a
   g  c    u  u      g  a  uacu     a ga  aagaaagg 
Get sequence
Deep sequencing
266 reads, 8.93 reads per million, 56 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 58550285-58550376 [+]
sense
OTTHUMT00000466427 ; ZSCAN1-001; intron 3
ENST00000282326 ; ZSCAN1-001; intron 3
Database links

Mature sequence hsa-miR-6807-5p

Accession MIMAT0027514
Sequence

1 - 

gugagccaguggaauggagagg

 - 22

Get sequence
Deep sequencing168 reads, 49 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6807-3p

Accession MIMAT0027515
Sequence

70 - 

cacugcauuccugcuuggcccag

 - 92

Get sequence
Deep sequencing65 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).