Stem-loop sequence hsa-mir-6806

AccessionMI0022651 (change log)
Symbol HGNC:MIR6806
DescriptionHomo sapiens miR-6806 stem-loop
Literature search

1 open access papers mention hsa-mir-6806
(1 sentences)

Stem-loop
   ugcu       c   agg      cca   uc a 
5'     cuguagg aug   cagggc   ggu  c u
       ||||||| |||   ||||||   |||  |  
3'     gacgucc uac   gucucg   ucg  g g
   ----       u   --a      aag   ua u 
Get sequence
Deep sequencing
312 reads, 0 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 58334688-58334751 [+]
sense
OTTHUMT00000466993 ; CTD-2583A14.10-003; intron 1
OTTHUMT00000469036 ; CTD-2583A14.10-006; intron 1
OTTHUMT00000466994 ; CTD-2583A14.10-004; intron 1
OTTHUMT00000466991 ; CTD-2583A14.10-001; intron 2
OTTHUMT00000466992 ; CTD-2583A14.10-002; intron 2
OTTHUMT00000466832 ; ZNF587B-003; intron 2
ENST00000593873 ; CTD-2583A14.10-003; intron 1
ENST00000603271 ; CTD-2583A14.10-006; intron 1
ENST00000598031 ; CTD-2583A14.10-004; intron 1
ENST00000316462 ; ZNF587B-201; intron 1
ENST00000597134 ; CTD-2583A14.10-001; intron 2
ENST00000596498 ; CTD-2583A14.10-002; intron 2
ENST00000594328 ; ZNF587B-003; intron 2
Database links

Mature sequence hsa-miR-6806-5p

Accession MIMAT0027512
Sequence

6 - 

uguaggcaugaggcagggcccagg

 - 29

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6806-3p

Accession MIMAT0027513
Sequence

43 - 

ugaagcucugacauuccugcag

 - 64

Get sequence
Deep sequencing301 reads, 72 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).