Stem-loop sequence hsa-mir-6805

AccessionMI0022650 (change log)
Symbol HGNC:MIR6805
DescriptionHomo sapiens miR-6805 stem-loop
Stem-loop
   uggccua        -cuu ug    guau      
5'        gggggcgg    g  gagu    gggcu 
          ||||||||    |  ||||    |||| g
3'        cccccgcc    c  cucg    uccga 
   -----ga        cccu gu    ---u      
Get sequence
Deep sequencing
299 reads, 28.3 reads per million, 53 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 55388181-55388242 [+]
sense
OTTHUMT00000141251 ; FCAR-009; intron 1
OTTHUMT00000141255 ; FCAR-013; intron 1
OTTHUMT00000141254 ; FCAR-012; intron 1
OTTHUMT00000141246 ; FCAR-004; intron 1
OTTHUMT00000141247 ; FCAR-005; intron 1
OTTHUMT00000141249 ; FCAR-007; intron 1
OTTHUMT00000141250 ; FCAR-008; intron 1
OTTHUMT00000141248 ; FCAR-006; intron 2
OTTHUMT00000141243 ; FCAR-001; intron 2
OTTHUMT00000141244 ; FCAR-002; intron 2
OTTHUMT00000141245 ; FCAR-003; intron 2
OTTHUMT00000141252 ; FCAR-010; intron 2
OTTHUMT00000141253 ; FCAR-011; intron 2
ENST00000391726 ; FCAR-009; intron 1
ENST00000488066 ; FCAR-013; intron 1
ENST00000472634 ; FCAR-012; intron 1
ENST00000353758 ; FCAR-004; intron 1
ENST00000359272 ; FCAR-005; intron 1
ENST00000391723 ; FCAR-007; intron 1
ENST00000391724 ; FCAR-008; intron 1
ENST00000469767 ; FCAR-006; intron 2
ENST00000355524 ; FCAR-001; intron 2
ENST00000391725 ; FCAR-002; intron 2
ENST00000345937 ; FCAR-003; intron 2
ENST00000482092 ; FCAR-010; intron 2
ENST00000471750 ; FCAR-011; intron 2
Database links

Mature sequence hsa-miR-6805-5p

Accession MIMAT0027510
Sequence

6 - 

uagggggcggcuuguggagugu

 - 27

Get sequence
Deep sequencing289 reads, 49 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6805-3p

Accession MIMAT0027511
Sequence

40 - 

uugcucugcucccccgcccccag

 - 62

Get sequence
Deep sequencing9 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).