Stem-loop sequence hsa-mir-6804

AccessionMI0022649 (change log)
Symbol HGNC:MIR6804
DescriptionHomo sapiens miR-6804 stem-loop
Literature search

1 open access papers mention hsa-mir-6804
(3 sentences)

Stem-loop
   ggaug  a     -uca       a   -  gg     
5'      ug gggug    gcaggug cgg ug  ggcc 
        || |||||    ||||||| ||| ||  ||| a
3'      ac cccac    cguccac gcc ac  ucgc 
   ----g  a     ucuc       -   g  ag     
Get sequence
Deep sequencing
67 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 55230885-55230952 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-6804
hsa-mir-6802chr19: 55239912-55239976 [-]
hsa-mir-6804chr19: 55230885-55230952 [-]
Database links

Mature sequence hsa-miR-6804-5p

Accession MIMAT0027508
Sequence

6 - 

ugagggugucagcaggugacg

 - 26

Get sequence
Deep sequencing64 reads, 27 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6804-3p

Accession MIMAT0027509
Sequence

47 - 

cgcaccugccucucacccacag

 - 68

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).