Stem-loop sequence hsa-mir-6803

AccessionMI0022648 (change log)
Symbol HGNC:MIR6803
DescriptionHomo sapiens miR-6803 stem-loop
Literature search

1 open access papers mention hsa-mir-6803
(3 sentences)

Stem-loop
   cuccu         -      -u  ---    g  g 
5'      cugggggug gggggc  gg   gcgu gu g
        ||||||||| ||||||  ||   |||| || a
3'      gacucccac cuuccg  cc   cgua cg c
   -----         u      cu  cua    g  a 
Get sequence
Deep sequencing
271 reads, 9.33 reads per million, 75 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 55245186-55245250 [-]
antisense
OTTHUMT00000442832 ; CTB-61M7.1-001; intron 1
OTTHUMT00000141147 ; KIR3DL3-001; intron 5
ENST00000402254 ; KIR3DL1-201; intron 1
ENST00000538269 ; KIR3DL1-202; intron 1
ENST00000541392 ; KIR3DL1-203; intron 1
ENST00000400864 ; CTB-61M7.1-001; intron 1
ENST00000396284 ; KIR2DL4-201; intron 1
ENST00000291860 ; KIR3DL3-001; intron 5
Clustered miRNAs
< 10kb from hsa-mir-6803
hsa-mir-6803chr19: 55245186-55245250 [-]
hsa-mir-6802chr19: 55239912-55239976 [-]
Database links

Mature sequence hsa-miR-6803-5p

Accession MIMAT0027506
Sequence

6 - 

cuggggguggggggcugggcgu

 - 27

Get sequence
Deep sequencing79 reads, 37 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6803-3p

Accession MIMAT0027507
Sequence

44 - 

ucccucgccuucucacccucag

 - 65

Get sequence
Deep sequencing124 reads, 51 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).