Stem-loop sequence hsa-mir-6802

AccessionMI0022647 (change log)
Symbol HGNC:MIR6802
DescriptionHomo sapiens miR-6802 stem-loop
Stem-loop
   gagg   -          cu     c cc   a 
5'     gcu aggugggggg  ugaag c  gag u
       ||| ||||||||||  ||||| |  |||  
3'     cga uccacucucc  acuuc g  cuc g
   --ga   a          cc     u ca   c 
Get sequence
Deep sequencing
238 reads, 0 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 55239912-55239976 [-]
antisense
OTTHUMT00000442832 ; CTB-61M7.1-001; intron 1
OTTHUMT00000141147 ; KIR3DL3-001; intron 4
ENST00000402254 ; KIR3DL1-201; intron 1
ENST00000538269 ; KIR3DL1-202; intron 1
ENST00000541392 ; KIR3DL1-203; intron 1
ENST00000400864 ; CTB-61M7.1-001; intron 1
ENST00000396284 ; KIR2DL4-201; intron 1
ENST00000291860 ; KIR3DL3-001; intron 4
Clustered miRNAs
< 10kb from hsa-mir-6802
hsa-mir-6803chr19: 55245186-55245250 [-]
hsa-mir-6802chr19: 55239912-55239976 [-]
hsa-mir-6804chr19: 55230885-55230952 [-]
Database links

Mature sequence hsa-miR-6802-5p

Accession MIMAT0027504
Sequence

6 - 

cuagguggggggcuugaagc

 - 25

Get sequence
Deep sequencing51 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6802-3p

Accession MIMAT0027505
Sequence

44 - 

uucaccccucucaccuaagcag

 - 65

Get sequence
Deep sequencing185 reads, 57 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).