Stem-loop sequence hsa-mir-6801

AccessionMI0022646 (change log)
Symbol HGNC:MIR6801
DescriptionHomo sapiens miR-6801 stem-loop
Stem-loop
   ----u    u   c  a     ca  aaa    --a  -u   c 
5'      ggcc ggu ag ggcag  gg   ugag   gu  agc a
        |||| ||| || |||||  ||   ||||   ||  ||| g
3'      ccgg uca uc ccguc  cc   acuc   cg  ucg g
   gaccc    -   c  a     -c  ---    aua  uu   a 
Get sequence
Deep sequencing
67 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 52222020-52222098 [+]
antisense
OTTHUMT00000466901 ; HAS1-002; intron 1
OTTHUMT00000466904 ; HAS1-004; intron 1
OTTHUMT00000466903 ; HAS1-003; intron 1
OTTHUMT00000466953 ; HAS1-005; intron 2
OTTHUMT00000466902 ; HAS1-001; intron 2
ENST00000601714 ; HAS1-002; intron 1
ENST00000601667 ; HAS1-004; intron 1
ENST00000594621 ; HAS1-003; intron 1
ENST00000222115 ; HAS1-005; intron 2
ENST00000540069 ; HAS1-001; intron 2
Database links

Mature sequence hsa-miR-6801-5p

Accession MIMAT0027502
Sequence

6 - 

uggucagaggcagcaggaaauga

 - 28

Get sequence
Deep sequencing29 reads, 20 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6801-3p

Accession MIMAT0027503
Sequence

55 - 

accccugccacucacuggcc

 - 74

Get sequence
Deep sequencing30 reads, 23 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).