Stem-loop sequence hsa-mir-6800

AccessionMI0022645 (change log)
Symbol HGNC:MIR6800
DescriptionHomo sapiens miR-6800 stem-loop
Stem-loop
   ac   ua     ca        cg        u    cu    c 
5'   cug  gguga  gucagggg  gggugugg gggg  gggg u
     |||  |||||  ||||||||  |||||||| ||||  ||||  
3'   gac  ccgcu  cgguccuc  uccacacu ccuc  cccc g
   --   cc     -a        --        -    --    g 
Get sequence
Deep sequencing
134 reads, 1.79 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 49832018-49832099 [+]
intergenic
Database links

Mature sequence hsa-miR-6800-5p

Accession MIMAT0027500
Sequence

5 - 

guaggugacagucaggggcgg

 - 25

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6800-3p

Accession MIMAT0027501
Sequence

59 - 

caccucuccuggcaucgcccc

 - 79

Get sequence
Deep sequencing31 reads, 19 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).