Stem-loop sequence hsa-mir-6799

AccessionMI0022644 (change log)
Symbol HGNC:MIR6799
DescriptionHomo sapiens miR-6799 stem-loop
Literature search

1 open access papers mention hsa-mir-6799
(1 sentences)

Stem-loop
   gagga     - g          u    uca ug 
5'      gggga g ugugcagggc gggg   c  a
        ||||| | |||||||||| ||||   |  c
3'      ccccu u guacgucccg cccc   g  u
   -gaca     g g          u    uuc uc 
Get sequence
Deep sequencing
118 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 49791866-49791934 [+]
intergenic
Database links

Mature sequence hsa-miR-6799-5p

Accession MIMAT0027498
Sequence

6 - 

ggggaggugugcagggcugg

 - 25

Get sequence
Deep sequencing66 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6799-3p

Accession MIMAT0027499
Sequence

47 - 

ugcccugcaugguguccccacag

 - 69

Get sequence
Deep sequencing42 reads, 17 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).