Stem-loop sequence hsa-mir-6798

AccessionMI0022643 (change log)
Symbol HGNC:MIR6798
DescriptionHomo sapiens miR-6798 stem-loop
Stem-loop
   ggcagc            c a cuu   cccauuc 
5'       cagggggauggg g g   ggg       c
         |||||||||||| | |   |||        
3'       gucccccuaccc c c   ccc       u
   ---gau            - - cau   auuccuu 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 49009906-49009972 [+]
antisense
OTTHUMT00000466137 ; LMTK3-002; intron 5
OTTHUMT00000466138 ; LMTK3-001; intron 6
ENST00000600059 ; LMTK3-002; intron 5
ENST00000270238 ; LMTK3-001; intron 6
Database links

Mature sequence hsa-miR-6798-5p

Accession MIMAT0027496
Sequence

6 - 

ccagggggaugggcgagcuuggg

 - 28

Get sequence
Deep sequencing8 reads, 8 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6798-3p

Accession MIMAT0027497
Sequence

47 - 

cuaccccccaucccccuguag

 - 67

Get sequence
Deep sequencing48 reads, 23 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).