Stem-loop sequence hsa-mir-6797

AccessionMI0022642 (change log)
Symbol HGNC:MIR6797
DescriptionHomo sapiens miR-6797 stem-loop
Stem-loop
   cagcca           gcugagaa    a   -  g 
5'       ggagggaaggg        cagg ccu gu c
         |||||||||||        |||| ||| ||  
3'       ccucccuuccc        gucc ggg ca u
   gacacc           ---aguac    g   u  c 
Get sequence
Deep sequencing
104 reads, 6.25 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 41869627-41869698 [+]
sense
OTTHUMT00000468595 ; CTC-435M10.3-002; intron 1
OTTHUMT00000398300 ; TMEM91-002; intron 1
OTTHUMT00000468596 ; TMEM91-014; intron 1
ENST00000604424 ; CTC-435M10.3-002; intron 1
ENST00000539627 ; TMEM91-002; intron 1
ENST00000604123 ; TMEM91-014; intron 1
antisense
OTTHUMT00000463489 ; B9D2-001; intron 1
OTTHUMT00000463490 ; B9D2-002; intron 1
OTTHUMT00000463491 ; B9D2-003; intron 1
ENST00000243578 ; B9D2-001; intron 1
ENST00000594416 ; B9D2-002; intron 1
ENST00000601597 ; B9D2-003; intron 1
Database links

Mature sequence hsa-miR-6797-5p

Accession MIMAT0027494
Sequence

6 - 

aggagggaaggggcugagaacagga

 - 30

Get sequence
Deep sequencing39 reads, 24 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6797-3p

Accession MIMAT0027495
Sequence

49 - 

ugcaugacccuucccuccccac

 - 70

Get sequence
Deep sequencing46 reads, 25 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).