Stem-loop sequence hsa-mir-6796

AccessionMI0022641 (change log)
Symbol HGNC:MIR6796
DescriptionHomo sapiens miR-6796 stem-loop
Stem-loop
   uuaccu       -uu        -------       
5'       ugugggg   ggagagcu       ggcugg 
         |||||||   ||||||||       ||||| u
3'       acgcccc   ccucucga       ccgacc 
   -----g       ucc        agacucc       
Get sequence
Deep sequencing
88 reads, 2.38 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 40369846-40369907 [+]
antisense
OTTHUMT00000462507 ; FCGBP-001; intron 27
ENST00000221347 ; FCGBP-001; intron 27
Database links

Mature sequence hsa-miR-6796-5p

Accession MIMAT0027492
Sequence

6 - 

uugugggguuggagagcuggcug

 - 28

Get sequence
Deep sequencing39 reads, 22 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6796-3p

Accession MIMAT0027493
Sequence

42 - 

gaagcucuccccuccccgcag

 - 62

Get sequence
Deep sequencing31 reads, 14 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).