Stem-loop sequence hsa-mir-6795

AccessionMI0022640 (change log)
Symbol HGNC:MIR6795
DescriptionHomo sapiens miR-6795 stem-loop
Stem-loop
   aggguug      ca       a  cu   uucau 
5'        ggggga  ggaugag gg  guc     u
          ||||||  ||||||| ||  |||     c
3'        cccccu  uuugcuc cc  cag     c
   -----ga      uc       c  ac   uucuc 
Get sequence
Deep sequencing
52 reads, 3.45 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 15179283-15179350 [-]
intergenic
Database links

Mature sequence hsa-miR-6795-5p

Accession MIMAT0027490
Sequence

6 - 

uggggggacaggaugagaggcugu

 - 29

Get sequence
Deep sequencing14 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6795-3p

Accession MIMAT0027491
Sequence

48 - 

accccucguuucuucccccag

 - 68

Get sequence
Deep sequencing26 reads, 15 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).