Stem-loop sequence hsa-mir-6794

AccessionMI0022639 (change log)
Symbol HGNC:MIR6794
DescriptionHomo sapiens miR-6794 stem-loop
Gene family MIPF0001726; mir-6794
Literature search

1 open access papers mention hsa-mir-6794
(2 sentences)

Stem-loop
   --   cgca                   --   ccag 
5'   ggg    gggggacugggggugagca  ggc    a
     |||    |||||||||||||||||||  |||     
3'   ucc    cucccugacucucacucgu  ucg    a
   ga   ----                   gc   accc 
Get sequence
Deep sequencing
82 reads, 26.1 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 12852260-12852327 [+]
sense
OTTHUMT00000450922 ; ASNA1-002; intron 2
OTTHUMT00000450923 ; ASNA1-003; intron 2
OTTHUMT00000450921 ; ASNA1-001; intron 3
ENST00000586561 ; ASNA1-002; intron 2
ENST00000590633 ; ASNA1-003; intron 2
ENST00000357332 ; ASNA1-201; intron 2
ENST00000591090 ; ASNA1-001; intron 3
Database links

Mature sequence hsa-miR-6794-5p

Accession MIMAT0027488
Sequence

6 - 

cagggggacugggggugagc

 - 25

Get sequence
Deep sequencing53 reads, 11 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6794-3p

Accession MIMAT0027489
Sequence

47 - 

cucacucucagucccucccu

 - 66

Get sequence
Deep sequencing20 reads, 12 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).