Stem-loop sequence hsa-mir-6793

AccessionMI0022638 (change log)
Symbol HGNC:MIR6793
DescriptionHomo sapiens miR-6793 stem-loop
Stem-loop
   guca        ucu         u aua  ca 
5'     cugugggu   ggguugggg g   ca  a
       ||||||||   ||||||||| |   ||   
3'     gacgcccg   cccaacccc c   gu  g
   ----        -uc         u cca  cc 
Get sequence
Deep sequencing
203 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 10828973-10829035 [+]
sense
OTTHUMT00000452590 ; DNM2-006; 3'UTR (exon 1)
OTTHUMT00000452591 ; DNM2-002; 3'UTR (exon 1)
OTTHUMT00000452604 ; DNM2-010; 3'UTR (exon 1)
OTTHUMT00000452592 ; DNM2-001; 3'UTR (exon 1)
OTTHUMT00000452593 ; DNM2-003; 3'UTR (exon 1)
ENST00000585892 ; DNM2-006; 3'UTR (exon 1)
ENST00000359692 ; DNM2-002; 3'UTR (exon 1)
ENST00000389253 ; DNM2-010; 3'UTR (exon 1)
ENST00000355667 ; DNM2-001; 3'UTR (exon 1)
ENST00000408974 ; DNM2-003; 3'UTR (exon 1)
ENST00000314646 ; DNM2-201; 3'UTR (exon 1)
Database links

Mature sequence hsa-miR-6793-5p

Accession MIMAT0027486
Sequence

6 - 

uguggguucuggguugggguga

 - 27

Get sequence
Deep sequencing137 reads, 52 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6793-3p

Accession MIMAT0027487
Sequence

44 - 

uccccaaccccugcccgcag

 - 63

Get sequence
Deep sequencing64 reads, 33 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).