Stem-loop sequence hsa-mir-6792

AccessionMI0022637 (change log)
Symbol HGNC:MIR6792
DescriptionHomo sapiens miR-6792 stem-loop
Literature search

1 open access papers mention hsa-mir-6792
(2 sentences)

Stem-loop
   ----gua          c    ugau u    -a  a 
5'        agcaggggcu uggg    g gagg  gc a
          |||||||||| ||||    | ||||  || c
3'        ucguccccga accu    c cucc  cg a
   uccuuac          c    ---- -    ca  g 
Get sequence
Deep sequencing
14 reads, 7.69 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 7617439-7617505 [+]
sense
OTTHUMT00000459295 ; PNPLA6-021; intron 2
OTTHUMT00000459286 ; PNPLA6-012; intron 18
OTTHUMT00000459280 ; PNPLA6-003; intron 20
OTTHUMT00000459282 ; PNPLA6-002; intron 20
OTTHUMT00000459275 ; PNPLA6-001; intron 21
OTTHUMT00000459283 ; PNPLA6-004; intron 21
ENST00000599951 ; PNPLA6-021; intron 2
ENST00000600737 ; PNPLA6-012; intron 18
ENST00000545201 ; PNPLA6-003; intron 20
ENST00000414982 ; PNPLA6-002; intron 20
ENST00000221249 ; PNPLA6-001; intron 21
ENST00000450331 ; PNPLA6-004; intron 21
Database links

Mature sequence hsa-miR-6792-5p

Accession MIMAT0027484
Sequence

1 - 

guaagcaggggcucuggguga

 - 21

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

Mature sequence hsa-miR-6792-3p

Accession MIMAT0027485
Sequence

42 - 

cuccuccacagccccugcucau

 - 63

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; meta-analysis [1]
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).